jueves, 16 de agosto de 2007

Cocina para exiliados (V): tortilla española

Seguimos con las patatas, y pasamos al plato español por excelencia. Porque, cuando hablamos de cocina española, en realidad la cosa tiene algo de trampa, ya que no hay una comida española propiamente dicha, sino casi tantas como pueblos hay en España; así, yo, que soy valenciano, no cocino normalmente lo mismo que un gallego o un vasco. Eso de la "cocina española" es un cubo demasiado grande con muchas cosas dentro que no tienen gran cosa que ver unas con otras, salvo en que casi todo está buenísimo.

Pero hay una excepción: la tortilla de patatas, o tortilla española. Ésa sí. Ésa está en cualquier bar de España, sea donde sea, si quiere retener la clientela. Y debe ser nutritiva a saco, a tenor de los éxitos de su inventor, que se cuenta que fue el general Zumalacárregui, el cual estaba formando el ejército real prácticamente de la nada, andaba escasillo de fondos (y así siguió toda la guerra), y tenía una alimentación de pobre de solemnidad, mientras iba esquivando a las columnas enemigas que le superaban en número varias veces y le perseguían con muy malas intenciones. Parece que, hartos ya de patatas guisadas, que era el rancho de rigor para su tropa, se decidió en su cuartel general cuajarlas con unos huevos que tenían, y los soldados devoraron el resultado. Y digo que debe ser nutritiva la tortilla, porque a partir de ahí al ejército de Zumalacárregui no lo paró nadie mientras vivió su general: deshicieron a toda columna enemiga que les puso delante y se hicieron los amos en el norte de España. Luego, posiblemente, algún espía enemigo debió hacerse con la receta de la tortilla española y la guerra se equilibró.

En Rusia no hay nada parecido a esto, aunque a los rusos les gusta presumir de inventores, una moda que viene del período estalinista y que ya comentaré en otra ocasión. Pero vamos con los ingredientes, para tres personas (si hay más gente, yo recomiendo cuajar dos o más en lugar de hacer una demasiado grande):

1. Cuatro huevos.
2. Tres patatas medianas (para hacerse una idea, cosa de medio kilo).
3. Aceite (unas seis cucharadas) y sal.
4. Dos cebollas medianas.

Uuuuyyy... lo de las cebollas es una cuestión peliaguda. La tortilla de patatas nació en una guerra civil y, aún hoy, divide a los españoles en dos bandos irreconciliables: unos la quieren con cebolla y otros no quieren ni oír hablar de eso. Yo, sinceramente, soy cebollista. Así pues, y con las prevenciones ya reseñadas en la entada anterior sobre la calidad de la patata rusa, lo cierto es uno de los platos más sencillos de reproducir en el extranjero, porque los ingredientes son fáciles de conseguir. Así se hace la tortilla española. Es más, así la hice yo ayer:
  1. Se corta la patata en láminas de un par de milímetros. Hay quien las corta a cuadrados o hace las lonchas más gruesas, pero, como lo hago yo, la patata se hace más rápidamente.
  2. Se pica la cebolla bien menuda.
  3. Se pone el aceite a calentar y, cuando está bien, pero no demasiado, se echa la patata y la cebolla. Yo dejo que la patata se fría un poco más de la cuenta, porque me gusta así (se ve claramente en la foto de la sartén), pero eso no es totalmente académico. La patata debe tomar color amarillo, pero no quedar crujiente. A punto de sacarla, se echa la sal a gusto, pero teniendo en cuenta que hay que echar más cuanta más cebolla tenga la tortilla.
  4. Se baten los huevos en un recipiente aparte. La clara y la yema deben quedar homogéneas. Hay discusión sobre si debe haber espuma al batir. Yo creo que no, porque puede cuajar demasiado después y hacerse dura.
  5. Cuando la patata y la cebolla estén a punto, se añaden a los huevos en el recipiente. Lo más correcto es esperar hasta que se enfríen para evitar que el huevo cuaje antes de tiempo, pero quien haga una cosa así es que está desganado.
  6. En la sartén debe quedar un poco de aceite, que ahora debe quedar muy caliente. Si no, hay que añadir lo que haga falta para que la tortilla no se pegue, porque éste es el momento decisivo.
  7. Con el aceite muy caliente, se echa todo a la sartén. Hay quien remueve con un tenedor hasta que empieza a cuajar, y entonces, con el mango de la sartén, se mueve para "hacer bailar" la tortilla. Si se pega, estamos perdidos, aunque no del todo, porque tendremos un revuelto de patatas, que también estará bueno, pero no es lo mismo.
  8. El momento de darle la vuelta suele ser bastante intuitivo y depende de que nos guste la tortilla bien seca o más jugosa (pero, para empezar, unos dos minutos ya da para que coja consistencia y se pueda pensar en darle la vuelta). Lo normal es darle la vuelta con un plato, y yo incluso lo hago con dos para más seguridad (y porque tengo lavavajillas). Se pasa de la sartén a un plato, se pone el otro encima en sentido contrario, se le da la vuelta al "platillo volante" que queda y se devuelve con cuidado la tortilla a la sartén.
  9. Se vuelve a agitar la sartén con el mango para que la tortilla baile.
  10. Al cabo de un minuto, o quizá un poco más, seguramente la tortilla ya está bien cuajada. Es cosa de retirarla de la sartén y pasarla a un plato. Y que aproveche.
Bueno, pues, después de esta explicación, me ha entrado hambre ¿Veis la foto de arriba de esta entrada? Pues aún queda media, pero dentro de poco ya no quedará.

6 comentarios:

Esther Hhhh dijo...

guuuuuaaaaaaaauuuuuuu Tortilla de patatas, mmmmmmmm. Sin duda el plato estrella. No sabía yo que era fruto de la guerra civil, fíjate tú.
Hace ya unos cuantos años mi padre estuvo trabajando de profe en Londres, y yo iba a verle en los veranos, justo antes de que se acabara del todo el curso para él. En el primer año, mi padre iba a unas clases de inglés para perfeccionarlo. Yo asistí con él a las dos últimas clases, incluyendo el último día que se hizo una excursión al parque de Greenwich para hacer un Picnic. Todas las compañeras de mi padre (si, todo mujeres) eran japonesas o chinas. El picnic consistía en llevar cada uno un plato cocinado, algo fácil pero tradicional del país. Las japonesas trajeron rollitos de arroz con pescado envuelto en algas, las chinas rollitos de primavera. La profe creo que trajo el postre, un pudding al más puro estilo inglés y mi padre, como no, trajo una tortilla de patatas. Fue la estrella, nosotros nos reíamos porque nos hacía gracia que nadie supiera que era eso, y lo fácil que es de preparar, con el curro que se habían llevado las japos. Pero nuestra abanderada triunfó. La profe, que está casada con un gallego, si la conocía, todo hay que decirlo.
Yo creo que en vez del águila, en la banderita española, podían poner una tortilla de patatas ¿no crees? jejejejeje...

Besitosssssss

PD: Madre del Amor Hermoso (no lo había dicho)

Gin dijo...

Cebolla, cebolla. El secreto de que una tortilla quede jugosa sin que tenga que estar "huevona" es que lleve mucha cebolla.

BAR dijo...

Yo también voto por la cebolla...jejeje,
Bueno, yo si que la he probado, y aunque no soy muy fan del huevo, pero a la tortilla española, nadie se le resiste...

Si siguieramos el consejo de Esther, creo que en mi bandera habría un "taco" en lugar de un aguila también...jejeje.

Me voy, ya con hambre después de tantos platillos típicos.

Un beso

Alfor dijo...

Me complace ver la mayoría cebollista entre los lectores comentaristas. Lamentablemente, en mi casa hay demsiados elementos díscolos con los que me toca transigir. Ya crecerán y reconocerán la verdad cebollista.

Esther Hhhh dijo...

Se me olvidó apuntar que yo soy cebollista y ajista tiernista si se tercia.. (que mal suena eso por dios)

Besitossssssss

ash dijo...

ABAJO CEBOLLISTAAAAAAAAAASS. El que quiera cebolla que se coja una y se la coma él solito. Pervertir la santidad de la tortilla es pecado desde la creación del universo. Algún dia la humanidad recobrará la cordura y todo será como debiera ser. Somos tan pocos los correctos que la lucha es ardua. Ya nos llegará la hora. De mientras sigo buscando una dimensión paralela en la que la evolución jamas creó la cebolla.

P.D. tiene que ser jugosita sin estar cruda.

P.P.D. Hubo una época en la que mi madre tenia que hacer tres tortillas diferentes en casa para contentar a todos, y ella la pobrecita comia de las tres.

P.P.P.D. la mejor tortilla del universo, la de mi madre. (como en casi todas las casas)